diff --git a/elixir/nucleotide-count/.exercism/config.json b/elixir/nucleotide-count/.exercism/config.json
new file mode 100644
index 0000000..bf74c04
--- /dev/null
+++ b/elixir/nucleotide-count/.exercism/config.json
@@ -0,0 +1,41 @@
+{
+  "authors": [
+    "rubysolo"
+  ],
+  "contributors": [
+    "andrewsardone",
+    "angelikatyborska",
+    "Cohen-Carlisle",
+    "dalexj",
+    "dantswain",
+    "devonestes",
+    "henrik",
+    "jinyeow",
+    "kytrinyx",
+    "leikind",
+    "lpil",
+    "MarcosX",
+    "neenjaw",
+    "nimser",
+    "parkerl",
+    "rud",
+    "sotojuan",
+    "Teapane",
+    "toriejw",
+    "waiting-for-dev"
+  ],
+  "files": {
+    "solution": [
+      "lib/nucleotide_count.ex"
+    ],
+    "test": [
+      "test/nucleotide_count_test.exs"
+    ],
+    "example": [
+      ".meta/example.ex"
+    ]
+  },
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "https://rosalind.info/problems/dna/"
+}
diff --git a/elixir/nucleotide-count/.exercism/metadata.json b/elixir/nucleotide-count/.exercism/metadata.json
new file mode 100644
index 0000000..eac3b20
--- /dev/null
+++ b/elixir/nucleotide-count/.exercism/metadata.json
@@ -0,0 +1 @@
+{"track":"elixir","exercise":"nucleotide-count","id":"fb05458eec1d47cb957f302624413711","url":"https://exercism.org/tracks/elixir/exercises/nucleotide-count","handle":"negrienko","is_requester":true,"auto_approve":false}
\ No newline at end of file
diff --git a/elixir/nucleotide-count/.formatter.exs b/elixir/nucleotide-count/.formatter.exs
new file mode 100644
index 0000000..d2cda26
--- /dev/null
+++ b/elixir/nucleotide-count/.formatter.exs
@@ -0,0 +1,4 @@
+# Used by "mix format"
+[
+  inputs: ["{mix,.formatter}.exs", "{config,lib,test}/**/*.{ex,exs}"]
+]
diff --git a/elixir/nucleotide-count/.gitignore b/elixir/nucleotide-count/.gitignore
new file mode 100644
index 0000000..2989ff0
--- /dev/null
+++ b/elixir/nucleotide-count/.gitignore
@@ -0,0 +1,24 @@
+# The directory Mix will write compiled artifacts to.
+/_build/
+
+# If you run "mix test --cover", coverage assets end up here.
+/cover/
+
+# The directory Mix downloads your dependencies sources to.
+/deps/
+
+# Where third-party dependencies like ExDoc output generated docs.
+/doc/
+
+# Ignore .fetch files in case you like to edit your project deps locally.
+/.fetch
+
+# If the VM crashes, it generates a dump, let's ignore it too.
+erl_crash.dump
+
+# Also ignore archive artifacts (built via "mix archive.build").
+*.ez
+
+# Ignore package tarball (built via "mix hex.build").
+nucleotide_count-*.tar
+
diff --git a/elixir/nucleotide-count/HELP.md b/elixir/nucleotide-count/HELP.md
new file mode 100644
index 0000000..c1e684e
--- /dev/null
+++ b/elixir/nucleotide-count/HELP.md
@@ -0,0 +1,75 @@
+# Help
+
+## Running the tests
+
+From the terminal, change to the base directory of the exercise then execute the tests with:
+
+```bash
+$ mix test
+```
+
+This will execute the test file found in the `test` subfolder -- a file ending in `_test.exs`
+
+Documentation:
+
+* [`mix test` - Elixir's test execution tool](https://hexdocs.pm/mix/Mix.Tasks.Test.html)
+* [`ExUnit` - Elixir's unit test library](https://hexdocs.pm/ex_unit/ExUnit.html)
+
+## Pending tests
+
+In test suites of practice exercises, all but the first test have been tagged to be skipped.
+
+Once you get a test passing, you can unskip the next one by commenting out the relevant `@tag :pending` with a `#` symbol.
+
+For example:
+
+```elixir
+# @tag :pending
+test "shouting" do
+  assert Bob.hey("WATCH OUT!") == "Whoa, chill out!"
+end
+```
+
+If you wish to run all tests at once, you can include all skipped test by using the `--include` flag on the `mix test` command:
+
+```bash
+$ mix test --include pending
+```
+
+Or, you can enable all the tests by commenting out the `ExUnit.configure` line in the file `test/test_helper.exs`.
+
+```elixir
+# ExUnit.configure(exclude: :pending, trace: true)
+```
+
+## Useful `mix test` options
+
+* `test/<FILE>.exs:LINENUM` - runs only a single test, the test from `<FILE>.exs` whose definition is on line `LINENUM`
+* `--failed` - runs only tests that failed the last time they ran
+* `--max-failures` - the suite stops evaluating tests when this number of test failures
+is reached
+* `--seed 0` - disables randomization so the tests in a single file will always be ran
+in the same order they were defined in
+
+## Submitting your solution
+
+You can submit your solution using the `exercism submit lib/nucleotide_count.ex` command.
+This command will upload your solution to the Exercism website and print the solution page's URL.
+
+It's possible to submit an incomplete solution which allows you to:
+
+- See how others have completed the exercise
+- Request help from a mentor
+
+## Need to get help?
+
+If you'd like help solving the exercise, check the following pages:
+
+- The [Elixir track's documentation](https://exercism.org/docs/tracks/elixir)
+- The [Elixir track's programming category on the forum](https://forum.exercism.org/c/programming/elixir)
+- [Exercism's programming category on the forum](https://forum.exercism.org/c/programming/5)
+- The [Frequently Asked Questions](https://exercism.org/docs/using/faqs)
+
+Should those resources not suffice, you could submit your (incomplete) solution to request mentoring.
+
+If you're stuck on something, it may help to look at some of the [available resources](https://exercism.org/docs/tracks/elixir/resources) out there where answers might be found.
\ No newline at end of file
diff --git a/elixir/nucleotide-count/README.md b/elixir/nucleotide-count/README.md
new file mode 100644
index 0000000..8634fe9
--- /dev/null
+++ b/elixir/nucleotide-count/README.md
@@ -0,0 +1,65 @@
+# Nucleotide Count
+
+Welcome to Nucleotide Count on Exercism's Elixir Track.
+If you need help running the tests or submitting your code, check out `HELP.md`.
+
+## Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
+All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
+A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```text
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```
+
+## Elixir-specific changes
+
+Error handling has been omitted from this exercise for the sake of simplicity.
+
+## Source
+
+### Created by
+
+- @rubysolo
+
+### Contributed to by
+
+- @andrewsardone
+- @angelikatyborska
+- @Cohen-Carlisle
+- @dalexj
+- @dantswain
+- @devonestes
+- @henrik
+- @jinyeow
+- @kytrinyx
+- @leikind
+- @lpil
+- @MarcosX
+- @neenjaw
+- @nimser
+- @parkerl
+- @rud
+- @sotojuan
+- @Teapane
+- @toriejw
+- @waiting-for-dev
+
+### Based on
+
+The Calculating DNA Nucleotides_problem at Rosalind - https://rosalind.info/problems/dna/
\ No newline at end of file
diff --git a/elixir/nucleotide-count/lib/nucleotide_count.ex b/elixir/nucleotide-count/lib/nucleotide_count.ex
new file mode 100644
index 0000000..d38bbf9
--- /dev/null
+++ b/elixir/nucleotide-count/lib/nucleotide_count.ex
@@ -0,0 +1,30 @@
+defmodule NucleotideCount do
+  @nucleotides [?A, ?C, ?G, ?T]
+
+  @doc """
+  Counts individual nucleotides in a DNA strand.
+
+  ## Examples
+
+  iex> NucleotideCount.count(~c"AATAA", ?A)
+  4
+
+  iex> NucleotideCount.count(~c"AATAA", ?T)
+  1
+  """
+  @spec count(charlist(), char()) :: non_neg_integer()
+  def count(strand, nucleotide), do: Enum.count(strand, &(&1 == nucleotide))
+
+  @doc """
+  Returns a summary of counts by nucleotide.
+
+  ## Examples
+
+  iex> NucleotideCount.histogram(~c"AATAA")
+  %{?A => 4, ?T => 1, ?C => 0, ?G => 0}
+  """
+  @spec histogram(charlist()) :: map()
+  def histogram(strand) do
+    for nucleotide <- @nucleotides, into: %{}, do: {nucleotide, count(strand, nucleotide)}
+  end
+end
diff --git a/elixir/nucleotide-count/mix.exs b/elixir/nucleotide-count/mix.exs
new file mode 100644
index 0000000..a22da50
--- /dev/null
+++ b/elixir/nucleotide-count/mix.exs
@@ -0,0 +1,28 @@
+defmodule NucleotideCount.MixProject do
+  use Mix.Project
+
+  def project do
+    [
+      app: :nucleotide_count,
+      version: "0.1.0",
+      # elixir: "~> 1.8",
+      start_permanent: Mix.env() == :prod,
+      deps: deps()
+    ]
+  end
+
+  # Run "mix help compile.app" to learn about applications.
+  def application do
+    [
+      extra_applications: [:logger]
+    ]
+  end
+
+  # Run "mix help deps" to learn about dependencies.
+  defp deps do
+    [
+      # {:dep_from_hexpm, "~> 0.3.0"},
+      # {:dep_from_git, git: "https://github.com/elixir-lang/my_dep.git", tag: "0.1.0"}
+    ]
+  end
+end
diff --git a/elixir/nucleotide-count/test/nucleotide_count_test.exs b/elixir/nucleotide-count/test/nucleotide_count_test.exs
new file mode 100644
index 0000000..12fb559
--- /dev/null
+++ b/elixir/nucleotide-count/test/nucleotide_count_test.exs
@@ -0,0 +1,44 @@
+defmodule NucleotideCountTest do
+  use ExUnit.Case
+
+  describe "count" do
+    test "empty dna string has no adenine" do
+      assert NucleotideCount.count(~c"", ?A) == 0
+    end
+
+    test "one nucleotide" do
+      assert NucleotideCount.count(~c"G", ?G) == 1
+    end
+
+    test "repetitive cytosine gets counted" do
+      assert NucleotideCount.count(~c"CCCCC", ?C) == 5
+    end
+
+    test "counts only thymine" do
+      assert NucleotideCount.count(~c"GGGGGTAACCCGG", ?T) == 1
+    end
+  end
+
+  describe "histogram" do
+    test "empty dna string has no nucleotides" do
+      expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 0}
+      assert NucleotideCount.histogram(~c"") == expected
+    end
+
+    test "one nucleotide" do
+      expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 1}
+      assert NucleotideCount.histogram(~c"G") == expected
+    end
+
+    test "repetitive sequence has only guanine" do
+      expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 8}
+      assert NucleotideCount.histogram(~c"GGGGGGGG") == expected
+    end
+
+    test "counts all nucleotides" do
+      s = ~c"AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+      expected = %{?A => 20, ?T => 21, ?C => 12, ?G => 17}
+      assert NucleotideCount.histogram(s) == expected
+    end
+  end
+end
diff --git a/elixir/nucleotide-count/test/test_helper.exs b/elixir/nucleotide-count/test/test_helper.exs
new file mode 100644
index 0000000..35fc5bf
--- /dev/null
+++ b/elixir/nucleotide-count/test/test_helper.exs
@@ -0,0 +1,2 @@
+ExUnit.start()
+ExUnit.configure(exclude: :pending, trace: true)